A carregar...
Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is...
Na minha lista:
| Main Authors: | , , , , , |
|---|---|
| Formato: | Artigo |
| Idioma: | en |
| Publicado em: |
1985
|
| Assuntos: | |
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC254841/ https://ncbi.nlm.nih.gov/pubmed/2985828 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|