טוען...
Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is...
שמור ב:
| Main Authors: | , , , , , |
|---|---|
| פורמט: | Artigo |
| שפה: | en |
| יצא לאור: |
1985
|
| נושאים: | |
| גישה מקוונת: | https://ncbi.nlm.nih.gov/pmc/articles/PMC254841/ https://ncbi.nlm.nih.gov/pubmed/2985828 |
| תגים: |
הוספת תג
אין תגיות, היה/י הראשונ/ה לתייג את הרשומה!
|