Đang tải...
Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is...
Đã lưu trong:
| Những tác giả chính: | , , , , , |
|---|---|
| Định dạng: | Bài viết |
| Ngôn ngữ: | en |
| Được phát hành: |
1985
|
| Những chủ đề: | |
| Truy cập trực tuyến: | https://ncbi.nlm.nih.gov/pmc/articles/PMC254841/ https://ncbi.nlm.nih.gov/pubmed/2985828 |
| Các nhãn: |
Thêm thẻ
Không có thẻ, Là người đầu tiên thẻ bản ghi này!
|