Đang tải...

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is...

Mô tả đầy đủ

Đã lưu trong:
Chi tiết về thư mục
Những tác giả chính: Casey, T A, Ruyechan, W T, Flora, M N, Reinhold, W, Straus, S E, Hay, J
Định dạng: Bài viết
Ngôn ngữ:en
Được phát hành: 1985
Những chủ đề:
Truy cập trực tuyến:https://ncbi.nlm.nih.gov/pmc/articles/PMC254841/
https://ncbi.nlm.nih.gov/pubmed/2985828
Các nhãn: Thêm thẻ
Không có thẻ, Là người đầu tiên thẻ bản ghi này!