A carregar...
The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.
The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and s...
Na minha lista:
| Main Authors: | , , |
|---|---|
| Formato: | Artigo |
| Idioma: | en |
| Publicado em: |
1982
|
| Assuntos: | |
| Acesso em linha: | https://ncbi.nlm.nih.gov/pmc/articles/PMC320607/ https://ncbi.nlm.nih.gov/pubmed/7201130 |
| Tags: |
Adicionar Tag
Sem tags, seja o primeiro a adicionar uma tag!
|